FANDOM


Pb egg

It's difficult to read :/

In this track, you can find an assortment of signs which appear to contain DNA code.

TutorialEdit

In Prison Break, get to the 4th checkpoint, immediately before entering the cafeteria. Jump up onto the roof lamp, the jump to the second. Drive forward very slowly until you see the light above the door in the background fall over, then back up and fall off of the light. You should land on the sloped table that is pointing backwards.

Roll to the back wall and you'll see that a trap door has been opened in the floor. Fall through the hole, then drive forward through the underground tunnel and you'll find the signs resting on the floor.

InvestigationEdit

There are multiple signs scattered around the room, accompanied by an electrical shorting/glow effect. They have the following DNA code printed on them:

CCGGCCAGCGGCCGGGCTCCCCAGCCACGCCCCTGCACCT

This is a fragment of the code for the gene SCNN1A, which encodes a "amiloride-sensitive sodium channel subunit"; a protein that helps regulate the flow of sodium in various membranes around the body.

ConfirmationEdit

This section is reserved for Confirmation/comments about this investigation. Investigations will remain open until advised by Redlynx that the final solution for each secret is found.

Ad blocker interference detected!


Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers

Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected.